Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.239950 |
Chromosome: | chromosome 12 |
Location: | 58888 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g483700 | RBP40,RB38 | Chloroplast-targeted RNA-binding protein; (1 of 2) PTHR10302//PTHR10302:SF8 - SINGLE-STRANDED DNA-BINDING PROTEIN // PROTEIN OSB2, CHLOROPLASTIC-RELATED | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCCCAACAGAGGGCGTGCGGCCTCTGGC |
Internal bar code: | AAGAGCGCTACGGTAGATGCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 571 |
LEAP-Seq percent confirming: | 64.3678 |
LEAP-Seq n confirming: | 56 |
LEAP-Seq n nonconfirming: | 31 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTTCCCCTGGAAGAGATTC |
Suggested primer 2: | CTCCAACACCCACACAGTTG |