Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.240148 |
Chromosome: | chromosome 17 |
Location: | 4358702 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g731350 | SDR28 | Short-chain dehydrogenase/reductase; (1 of 1) 1.1.1.184//1.1.1.189//1.1.1.197 - Carbonyl reductase (NADPH) / Xenobiotic ketone reductase // Prostaglandin-E(2) 9-reductase / Prostaglandin-E2 9-reductase // 15-hydroxyprostaglandin dehydrogenase (NADP(+)) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTGCCTGGACAGCGCCGGCCGCCGCCGC |
Internal bar code: | GTGTCAGGCAAGATGTCTGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 689 |
LEAP-Seq percent confirming: | 98.749 |
LEAP-Seq n confirming: | 1184 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AATATCAACTTTGCGGGCAC |
Suggested primer 2: | CAACGCACAACAAAATACGC |