Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.241054 |
Chromosome: | chromosome 4 |
Location: | 674694 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g217951 | LCI33 | Low-CO2-inducible protein; (1 of 9) IPR011011//IPR013083 - Zinc finger, FYVE/PHD-type // Zinc finger, RING/FYVE/PHD-type | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAACAAGCTCATCGACCCAGTGGATGACT |
Internal bar code: | AAGTATGGAGCAGACGCCTGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 218 |
LEAP-Seq percent confirming: | 99.3421 |
LEAP-Seq n confirming: | 151 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTACTTCAAGCAAGGGCCTG |
Suggested primer 2: | TGACAGCCTGGACAACAGAG |