Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.244016 |
Chromosome: | chromosome 16 |
Location: | 6802205 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g674627 | MKS1,B9D1 | (1 of 1) K16744 - B9 domain-containing protein 1 (B9D1); B9 Domain-Containing transition zone protein 1 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCTTTCAGCGCATTTATCTTAGCATATA |
Internal bar code: | GGCCCCGCTGGCAGGCACATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 519 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 12 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCATCGACCTGCAGCATAAG |
Suggested primer 2: | AACGAGTCCAGGCCATACAC |