Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.244340 |
Chromosome: | chromosome 3 |
Location: | 3050044 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g164250 | FAP262 | (1 of 1) PF00612//PF07714 - IQ calmodulin-binding motif (IQ) // Protein tyrosine kinase (Pkinase_Tyr); Flagellar Associated Protein 262, protein kinase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGTGGAAGTCGCTGCTGCGGAGTAGGCG |
Internal bar code: | TCTGTCAAGGCCGATAAGGCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 418 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACCTGGAGCTGGACTTCCT |
Suggested primer 2: | GAGACTGCCCAGAAGCAATC |