| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.244860 |
| Chromosome: | chromosome 3 |
| Location: | 6604355 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g196450 | (1 of 1) K15178 - RNA polymerase-associated protein RTF1 (RTF1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTTTGCAGCGGCATGTCTGCCGTGTCAGT |
| Internal bar code: | CTGAGCGCCCACGGATGAAAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 446 |
| LEAP-Seq percent confirming: | 97.037 |
| LEAP-Seq n confirming: | 393 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCCTTGCGCTTGATTAAC |
| Suggested primer 2: | TCTGTACTGATGTCGGCTGG |