| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.244955 |
| Chromosome: | chromosome 11 |
| Location: | 3248731 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g479750 | SRP54,cpSRP54,SRP54L | Chloroplast SRP54; (1 of 1) PTHR11564:SF7 - SIGNAL RECOGNITION PARTICLE 54 KDA PROTEIN, CHLOROPLASTIC | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCCCACCGCAACCAACCGAACCGATCGG |
| Internal bar code: | CGAGAACTCCTTGCTGTACCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 391 |
| LEAP-Seq percent confirming: | 99.4143 |
| LEAP-Seq n confirming: | 5601 |
| LEAP-Seq n nonconfirming: | 33 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAGGGAAACGATATAGGCG |
| Suggested primer 2: | AAAGACGGTGTGGACAAAGG |