| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.248315 |
| Chromosome: | chromosome 1 |
| Location: | 7489804 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g053850 | (1 of 2) K10143 - E3 ubiquitin-protein ligase RFWD2 (RFWD2, COP1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACAGCCACGACGACGACGACGACGAGGAT |
| Internal bar code: | CCAGATACTGTGCAACCCATTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 0 |
| LEAP-Seq percent confirming: | 0.0 |
| LEAP-Seq n confirming: | 0 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 0 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACACGCCGTCATAGTCTCC |
| Suggested primer 2: | CTGTCGTCTCTGTCGTTGGA |