Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.250199 |
Chromosome: | chromosome 4 |
Location: | 2956752 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g224800 | VAMP4,VAMP74,VAM4 | (1 of 3) PTHR21136:SF4 - N-SYNAPTOBREVIN, ISOFORM J; Endosomal R-SNARE protein, Vamp7/Nyv1-family (R.III) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACAAAGCCACCAAGCTGGAGGGCAAGAGC |
Internal bar code: | TCAGTGCCTCAATGATCGGTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 607 |
LEAP-Seq percent confirming: | 98.7261 |
LEAP-Seq n confirming: | 155 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGAAGACAGCAGCCGTATG |
Suggested primer 2: | AGGCACACGCACACAGATAG |