| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.252629 |
| Chromosome: | chromosome 11 |
| Location: | 987141 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467665 | (1 of 1) IPR002909//IPR006626//IPR011050//IPR014756//IPR019316 - IPT domain // Parallel beta-helix repeat // Pectin lyase fold/virulence factor // Immunoglobulin E-set // G8 domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTCAGTGTACGTCCCTGTGACCTATTTC |
| Internal bar code: | CAGTGTGTCCGAGATAAACCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 788 |
| LEAP-Seq percent confirming: | 99.4039 |
| LEAP-Seq n confirming: | 1334 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAAAGGTCCTGCTTGCCTG |
| Suggested primer 2: | TTGAAATGCAGCAGGACAAG |