Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.253048 |
Chromosome: | chromosome 7 |
Location: | 4832524 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g345900 | DCL3 | Dicer-like protein; (1 of 1) PTHR11207//PTHR11207:SF0//PTHR14950 - RIBONUCLEASE III // RIBONUCLEASE 3 // HELICASE-RELATED | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGGAGACATCAACGGGGCCCGGCTGAGG |
Internal bar code: | GCTCAGGGGCTCGGTTTGACCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 599 |
LEAP-Seq percent confirming: | 11.7588 |
LEAP-Seq n confirming: | 704 |
LEAP-Seq n nonconfirming: | 5283 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCGTGTGTGTGTGTGTGTGT |
Suggested primer 2: | TTGTCGACGTTGACTTAGCG |