Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.253212 |
Chromosome: | chromosome 9 |
Location: | 1824308 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g396000 | NAR5,NRT2C | Nitrate/nitrite transporter; (1 of 4) K02575 - MFS transporter, NNP family, nitrate/nitrite transporter (NRT, narK, nrtP, nasA) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAATGCGCGGTCGCATCTGCGCTCTCTGG |
Internal bar code: | GAGTCGAATGGCTTGGTTCGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 915 |
LEAP-Seq percent confirming: | 99.6304 |
LEAP-Seq n confirming: | 4313 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGCTTGAGTAAGCGGGAAC |
Suggested primer 2: | GATGGGGGAGGGTTGTAGAT |