Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.254328 |
Chromosome: | chromosome 5 |
Location: | 2254224 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g234663 | SRTC1,SRTC | (1 of 1) PTHR11085:SF23 - NAD-DEPENDENT HISTONE DEACETYLASE HST4; Sir2-like NADH dependent histone deacetylase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATCAGACATGTAGGTGCGGCGAGGCACGC |
Internal bar code: | TTGTATACGCTAAAGAGACGAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 632 |
LEAP-Seq percent confirming: | 99.5493 |
LEAP-Seq n confirming: | 5080 |
LEAP-Seq n nonconfirming: | 23 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTCCATATTTAGCGGCTTG |
Suggested primer 2: | TCCTACCATCCCATTTCAGC |