| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.256551 |
| Chromosome: | chromosome 9 |
| Location: | 1771375 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g396400 | UBQ2 | Bi-ubiquitin; (1 of 1) K12158 - ubiquitin-like protein Nedd8 (NEDD8) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGTGGCGCTCATGGCGGAGCTGAGGTGG |
| Internal bar code: | CAAGCAGACTGGGCACGACAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 647 |
| LEAP-Seq percent confirming: | 96.6991 |
| LEAP-Seq n confirming: | 2285 |
| LEAP-Seq n nonconfirming: | 78 |
| LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACATGAGGAGACCTTGACGG |
| Suggested primer 2: | ATTTGGTGCTGTAAGGTGGC |