| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.SG0182.000676 |
| Chromosome: | chromosome 12 |
| Location: | 6884557 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g560900 | CPLD35,AOF7 | Flavin-containing amine oxidase. Conserved in plant lineage and Diatoms; (1 of 2) 1.3.5.5 - 15-cis-phytoene desaturase / Plant-type phytoene desaturase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGGCGAGGACGCCGGCATC |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 695 |
| LEAP-Seq percent confirming: | 98.7179 |
| LEAP-Seq n confirming: | 77 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTGGGAATTAGATGCACCC |
| Suggested primer 2: | CGACCACCAACACATCACTC |