| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.000805 |
| Chromosome: | chromosome 14 |
| Location: | 1927972 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g621000 | SPL27 | Pre-mRNA splicing factor; (1 of 1) K12869 - crooked neck (CRN, CRNKL1, CLF1, SYF3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGGGTGGTTATGCTCGCTCA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 864 |
| LEAP-Seq percent confirming: | 90.3614 |
| LEAP-Seq n confirming: | 75 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTTAACCCCCTTCCATTC |
| Suggested primer 2: | AAGAGTTAAACGCCAGCGAA |