| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.003514 |
| Chromosome: | chromosome 12 |
| Location: | 3243977 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g498500 | DEG1C,DEG11 | (1 of 1) PF00089//PF13180 - Trypsin (Trypsin) // PDZ domain (PDZ_2); Deg protease | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCGTCATGGCGTCCCACCG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1122 |
| LEAP-Seq percent confirming: | 98.4127 |
| LEAP-Seq n confirming: | 186 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGGTCAGTAGCGACAAGC |
| Suggested primer 2: | ATCAGGAGAAAGGACGGGTT |