| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.003906 |
| Chromosome: | chromosome 17 |
| Location: | 6035359 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g740950 | LHL4,ELIP6,ELI6 | (1 of 12) IPR022796//IPR023329 - Chlorophyll A-B binding protein // Chlorophyll a/b binding protein domain; LHC-like protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCATCGTTCCCACCTCTCACG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1385 |
| LEAP-Seq percent confirming: | 98.6842 |
| LEAP-Seq n confirming: | 525 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCCGTACATCCTTGTTTGG |
| Suggested primer 2: | GCATCAAACCTCCCCTAACA |