| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.006221 |
| Chromosome: | chromosome 12 |
| Location: | 4803793 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g524350 | HUS1 | DNA damage checkpoint protein; (1 of 1) K10903 - HUS1 checkpoint protein (HUS1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAATGCCTGCCGGTTGTGCG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1252 |
| LEAP-Seq percent confirming: | 89.6714 |
| LEAP-Seq n confirming: | 382 |
| LEAP-Seq n nonconfirming: | 44 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGGGTTGGTGTACTTCGG |
| Suggested primer 2: | CAGCTTCGCAGGACAATACA |