| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.009710 |
| Chromosome: | chromosome 10 |
| Location: | 4447953 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g451600 | SRR28,SRR28B | (1 of 1) PF00059//PF00704//PF14295 - Lectin C-type domain (Lectin_C) // Glycosyl hydrolases family 18 (Glyco_hydro_18) // PAN domain (PAN_4); Lectin-domain glycosyl hydrolase | MULTIPLE_SPLICE_VARIANTS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTACTGCATTGCCATATGCTT |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1370 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 391 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTCTTGGCTAGCTCCCTGT |
| Suggested primer 2: | GGAAGGATGGTCAGGACAGA |