| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.SG0182.014284 |
| Chromosome: | chromosome 4 |
| Location: | 3797862 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g229550 | SRR15 | Scavenger receptor cysteine rich (SRCR) protein; (1 of 5) 1.4.3.13 - Protein-lysine 6-oxidase / Lysyl oxidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACACCCGGTCGGACTCACA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 595 |
| LEAP-Seq percent confirming: | 95.0472 |
| LEAP-Seq n confirming: | 403 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGTGAAAGTGCATTTGGG |
| Suggested primer 2: | GCACAATCACAATCAATCGC |