| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.014450 |
| Chromosome: | chromosome 1 |
| Location: | 4529451 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g030850 | POA4 | 20S proteasome alpha subunit D; (1 of 1) K02731 - 20S proteasome subunit alpha 4 (PSMA7) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGAGCCAGCACGCTGCTA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1552 |
| LEAP-Seq percent confirming: | 98.2869 |
| LEAP-Seq n confirming: | 918 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTATCTACAACCCCTCCCCC |
| Suggested primer 2: | CAGTGAGTCCTAGCCAAGCC |