Insertion cassette: | pMJ013b |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.SG0182.016100 |
Chromosome: | chromosome 17 |
Location: | 2875955 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g719500 | AOF9 | (1 of 2) 1.3.99.29 - Phytoene desaturase (zeta-carotene-forming) / 2-step phytoene desaturase; Flavin-containing amine oxidase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCAACACCGGCGGACTCCG |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1356 |
LEAP-Seq percent confirming: | 99.9048 |
LEAP-Seq n confirming: | 3149 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGGTTCATTGTTCTTCGCAT |
Suggested primer 2: | GGACAAATGCGACGTAACCT |