| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.SG0182.016545 |
| Chromosome: | chromosome 16 |
| Location: | 5258941 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g682550 | (1 of 1) PF08016//PF08263//PF13855 - Polycystin cation channel (PKD_channel) // Leucine rich repeat N-terminal domain (LRRNT_2) // Leucine rich repeat (LRR_8) | MULTIPLE_SPLICE_VARIANTS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGCTCTTGATGTCCCCTA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 514 |
| LEAP-Seq percent confirming: | 96.25 |
| LEAP-Seq n confirming: | 77 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTTTGATTGACGGGACAAA |
| Suggested primer 2: | GCTCTGCTGGTTCTACGTCC |