| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.SG0182.019293 |
| Chromosome: | chromosome 3 |
| Location: | 6352007 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g193800 | TSN1 | Aspartyl-tRNA synthetase; (1 of 1) 6.1.1.22 - Asparagine--tRNA ligase / Asparaginyl-tRNA synthetase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGTGCGCACGATCGAGAAA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 872 |
| LEAP-Seq percent confirming: | 98.5981 |
| LEAP-Seq n confirming: | 211 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCGTCTTTTGGGTGTGGT |
| Suggested primer 2: | CTTCTGTGCATTGCCACTGT |