| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.019683 |
| Chromosome: | chromosome 7 |
| Location: | 1422793 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g322950 | NADK1,NDK1 | ATP-NAD kinase; (1 of 1) PTHR20275//PTHR20275:SF6 - FAMILY NOT NAMED // NADH KINASE POS5, MITOCHONDRIAL | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCACCACCACCATCCGACCC |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1408 |
| LEAP-Seq percent confirming: | 98.3322 |
| LEAP-Seq n confirming: | 2889 |
| LEAP-Seq n nonconfirming: | 49 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCACGAGCTGTGGAATGAG |
| Suggested primer 2: | AGTAAGCGCATTGTGACACG |