| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.000679 |
| Chromosome: | chromosome 12 |
| Location: | 4934851 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g524300 | CGL71,PYG7 | (1 of 7) 2.4.1.255 - Protein O-GlcNAc transferase / OGTase; Pale yellow green 7, a PSI assembly factor | 3'UTR |
| Cre12.g524350 | HUS1 | DNA damage checkpoint protein; (1 of 1) K10903 - HUS1 checkpoint protein (HUS1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGAGCTGGAGCGCTAGAGGGCTGGAGCTGGGACCTGGTGGGACCTGAT |
| Internal bar code: | AGTGCTGTTCTCAAAGGTAGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1553 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCTAAAATTGGCGCCGATG |
| Suggested primer 2: | ATCCGTTGCACTTGCCAAAC |