| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.002076 |
| Chromosome: | chromosome 16 |
| Location: | 6037038 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g678050 | SRS14,SRE3 | Pre-mRNA splicing factor, SR-related; (1 of 1) K13171 - serine/arginine repetitive matrix protein 1 (SRRM1, SRM160) | 3'UTR |
| Cre16.g678100 | VPS28 | (1 of 1) K12184 - ESCRT-I complex subunit VPS28 (VPS28); Subunit of the ESCRT-I complex | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAAGGATCGAGTTTCCGTGCGCCCCTCGGATCAGGGCTGATGAGTAGGG |
| Internal bar code: | GCCATGTTACTCCTTGTATGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3968 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 61 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 61 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTTCATGTTGACGCGGTGA |
| Suggested primer 2: | TTTGGGGTTGTTGAAGGGCT |