| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.004047 |
| Chromosome: | chromosome 12 |
| Location: | 7723320 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g554800 | PRK1 | (1 of 1) 2.7.1.19 - Phosphoribulokinase / Phosphopentokinase; Phosphoribulokinase, chloroplastic | 3'UTR |
| Cre12.g554850 | TRXH2,TRX7,TRXh2,TRXh2a | (1 of 9) K03671 - thioredoxin 1 (trxA); Thioredoxin h2, cytosolic | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAAAATCTGCAATTTGGTACCTGCGACCGCACAGCAACTATGACTGCAGC |
| Internal bar code: | TGGTGCTGATTCTCTTACATAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1250 |
| LEAP-Seq percent confirming: | 89.1892 |
| LEAP-Seq n confirming: | 33 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCAGGCTCAATACCAAGGG |
| Suggested primer 2: | TCCATGCCTAATGCCTGCAA |