| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.104890 |
| Chromosome: | chromosome 9 |
| Location: | 3016275 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g387400 | POLZ1 | DNA polymerase zeta; (1 of 1) K02350 - DNA polymerase zeta (POLZ1, rev3) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCACCCATGCATGCACCACCCCGCCCTC |
| Internal bar code: | CACTGCTAGCGGTTGAGGCCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 143 |
| LEAP-Seq percent confirming: | 93.5 |
| LEAP-Seq n confirming: | 187 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTGTGTGTGCGTGTGTGT |
| Suggested primer 2: | ACCTTAGCGTCAAATGTGGG |