| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.165919 |
| Chromosome: | chromosome 12 |
| Location: | 7097185 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g559350 | SDR23 | Short-chain dehydrogenase/reductase; (1 of 1) 1.1.1.101 - Acylglycerone-phosphate reductase / Palmitoyldihydroxyacetone-phosphate reductase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGCGCTGGGCGGGTGGGCGGGTGCGAGG |
| Internal bar code: | TGATGACGGTCGCGGCCAGCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 212 |
| LEAP-Seq percent confirming: | 74.1936 |
| LEAP-Seq n confirming: | 69 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCTGCCTGACTTGATTTG |
| Suggested primer 2: | CACACACACACACACACCGT |