Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.225746 |
Chromosome: | chromosome 5 |
Location: | 2501229 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g235700 | (1 of 2) K12382 - saposin (PSAP, SGP1) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCATGTGGACCGCGGCGACCAAGTTTGCG |
Internal bar code: | TCCGTCGGGCACGAGCGTATGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 663 |
LEAP-Seq percent confirming: | 98.7982 |
LEAP-Seq n confirming: | 1562 |
LEAP-Seq n nonconfirming: | 19 |
LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCAAATCAGGAGTCGGCTA |
Suggested primer 2: | TTAAATCCTATTCCGCCACG |